As with most of the experiments in this course, you will be handling a variety of undomesticated organisms of unknown identity or pathogenicity. Handle all cultures with respect and using standard microbiological procedure.

Gel electrophoresis involves dangerous electric currents. Always turn the power supply off AND disconnect the leads from the gel before approaching the electrophoresis chamber.

After electrophoresis, the TA will remove the gel and soak it in ethidium bromide stain before photography. Only the TA should handle ethidium bromide or anything that contacts it. ETHIDIUM BROMIDE IS A CARCINOGEN.

Most Microbiology labs involve an "unknown". Rather than identify some boring standard teaching lab bacterium from a pure culture or simple mixture, in this experiment you will isolate something, probably several somethings, who knows what, from environmental samples you bring in, and then identify them phylogenetically from the sequence of their small subunit ribosomal RNAs.

The experiment has three components:

1. The isolation of some organisms,
2. Some molecular biology that results in ssu-rRNA sequences from these organisms, and
3. The molecular phylogenetic analysis of these sequence (this is the Term Project).

Materials

• whatever media is at hand
• whatever source of innoculum is at hand

Procedure

1. Decide which of the environmental samples you brought in you want to use for innoculum - any of them should do. Alternatively, you can take a swab or sample of anything else - use your imagination!
2. Streak this innoculum onto whatever media is available and interesting to you. Incubate at 30C (or whatever temp is available or desired)
3. Examine the resulting colonies and pick a few interesting ones for microscopic examination. The key here is to find something different - colored, odd shape, funny edges, whatever. Go for the oddballs! Decide on two to go with and make extensive notes on both colony and microscopic morphology.
4. Restreak these organisms and incubate as before
5. If needed, restreak and incubate once again to get a pure culture. Examine microscopically to make sure nothing has changed.

Some of you may not get any isolated colonies, or may have interesting cultures from one of your other experiments that you'd like to do the ssu-rRNA PCR and term project on - that's fine, use whatever you have available to you for the rest of the experiment.

Be careful at all times to avoid contamination

• Always use filter sterilized distilled water
• Autoclave all tips and tubes and wear gloves
• Use clean, untouched disposable plasticware

Materials

                                       XbaI

         515FPL (515-533)     5' GCGGATCCTCTAGACTGCAGTGCCAGCAGCCGCGGTAA 3' 
                                   BamHI       PstI
     
                                       NotI
         1492RPL (1510-1492)  5' GGCTCGAGCGGCCGCCCGGGTTACCTTGTTACGACTT 3'
                                   XhoI        XmaI
      

Procedure

1. Touch one of your unknown colonies with a sterile loop, then swirl the loop in 50ul of PCR premix in an 0.5ml microfuge tube. Repeat this with your other unknowns in separate PCR premix tubes.
2. Add 3 drops of mineral oil to each of these tubes to cover the liquid, and keep on ice until ready to load into thermocycler.
3. Run PCR program 71:

• File 71 = 94C 2 min (hot start), link to file 72
• File 72 = 92C 1.5 min (template denaturation), 50C 1.5 min (primer annealing), 72C 0.5 min (primer extension),
  repeated 30 times, then link to file 73
• File 73 = 72C 7 min (additional extension time), link to file 74
• File 74 = 4C indefinitely (cold storage)

Materials

• 1% agaorose gel in TAE
• 10X TBJ (loading buffer w/ dye)
• 1ug/ml ethidium bromide in a tupperware tub
• parafilm
• P20 pipet tips
• agarose mingel units w/ combs & leads
• microwave oven
• kimwipes
• photodocumentation system
• PCR reactions from the previous lab
• power supply

Procedure

1. Spot 1ul of 10X TBJ onto a small piece of parafilm.
2. Draw 10ul from the PCR reaction through the mineral oil layer. Wipe the pipet tip off with a Kimwipe, then transfer onto one of the TBJ spots on the parafilm.
3. Mix the sample and loading dye by repeated pipetting.
4. Load the sample into a well of the gel. The samples should be loaded in sequence according to a list so that the order of sample is known. The TA will load a negative control reation and a sample of 1Kb molecular weight ladder.
5. Electrophorese at 100 volts for 1 hour. The bromophenol blue dye should migrate to between half and 3/4's of the length of the gel (the xylene cyanol will migrate 1/2 as far).
6. Soak the gel in ethidium bromide for 30 minutes to stain the DNA. Examine the gel on the transilluminator, capture and print the image.

The gels should look something like this:

Materials

• NucleoSpin II extraction kits (ClonTech)
• 1.5ml microfuge tubes & microfuge
• PCR reactions from the previous experiments

Procedure

This procedure is described in detail in the protocol and booklet supplied in the kit:

• NucleoSpin II extraction kit short protocol (24Kbyte PDF)
• NucleoSpin II extraction kit booklet (572Kbyte PDF)

1. Collect the PCR reaction (leave the mineral oil behind) with a pipet gun, wipe off excess oil from the tip, and transfer to a clean 1.5ml microfuge tube. If there is any oil carried over into the new tube, draw it out with a pipet tip & discard.
2. Add 100ul of buffer NT to the sample and mix by vortexing.
3. Insert a NucleoSpin column into the collection tube. Pipet the sample into the column, and centrifuge for 1 min. Discard the flow-through liquid.
4. Put the column back into the collection tube, and add 600ul NT3. Centrifuge for 1 min., and discard the flow-through liquid.
5. Put the column back into the collection tube, and centrifuge for 2 min. to remove any residual buffer.
6. Transfer the NucleoSpin column to a clean 1.5ml centrifuge tube (discard the collection tube).
7. Add 50ul buffer NE. Incubate at room temperature for 1 min, and then centrifuge 1 min. Discard the column, and label the centrifuge tube with your culture number and initials.

The TA will measure the A260 of all of the purified PCR products estimate their concentration, and they will be diluted appropriately and sent to the DNA Sequencing Facility for sequencing with primer 515F. The sequence that comes back is the starting point for your term project.